Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0008305 (circPTK2) | |||
Gene | PTK2 | Organism | Human |
Genome Locus | Build | hg19 | |
Disease | Non-Small Cell Lung Cancer | ICD-10 | Malignant neoplasm of bronchus and lung (C34) |
DBLink | PMID | 30261900 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | Seventy-three fresh NSCLC tissues and paired adjacent noncancerous lung tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward ACATTATTGGCCACTGTGGATGAG ReverseGGGCCAGTTTCATCTTGTTGATGAG | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Wang, L, Tong, X, Zhou, Z, Wang, S, Lei, Z, Zhang, T, Liu, Z, Zeng, Y, Li, C, Zhao, J, Su, Z, Zhang, C, Liu, X, Xu, G, Zhang, HT (2018). Circular RNA hsa_circ_0008305 (circPTK2) inhibits TGF-펲-induced epithelial-mesenchymal transition and metastasis by controlling TIF1펳 in non-small cell lung cancer. Mol. Cancer, 17, 1:140. |